TABLE 1 

List of primers

PrimerSequence (5′–3′)Construct
FO397GGGCATATCCATATGACTACTCTTCCCAATAC6×His-CT813
FO398ACGCGTCGACTCACTATATCGAACCACGTCTTCC
 
FO498AAGGAAAAAAGCGGCCGCATGACTACTCTTCCCAATAATTGpBomb4-CT813-Tet
FO499ACGCGTCGACCTACTTGTCATCGTCATCCTTGTAGTCTATCGAACCACGTCTTCC
 
FO541AACTGCAGATGACTACTCTTCCCAATACTTGTACTTCAFlag-CT813
FO543CCCAAGCTTCTATATCGAACCACGTCTTCCTGG
 
FO661CGAGGTACCATGGGGAACATCTTCGCCARF1 WT-HA
FO662CTGCAACTCGAGCTTCTGGTTCCGGAGCTGATTARF1 Q71L-HA
FO663CGAGGTACCATGGGCAATATCTTTGGAAACCARF3-HA
FO664CTGCAACTCGAGCTTCTTGTTTTTGAGCTGATTGGC
 
FO665CTAGGTACCATGGGCCTCACTATCTCCTCCARF4-HA
FO666CTGCAACTCGAGACGTTTTGAAAGCTCATTTGACAG
 
FO667ATAGGTACCATGGGCCTCACCGTGTCCARF5-HA
FO668CTGCAACTCGAGGCGCTTTGACAGCTCGTG
 
FO669ATAGGTACCATGGGGAAGGTGCTATCCAAAAARF6-HA
FO670CTGCAACTCGAGAGATTTGTAGTTAGAGGTTAACCATGTG
 
FO704GATCGTGACCACCATTCCCAACATAGGCTTCAACGTGGAAACCGTGGARF1 T48N-HA
FO705GTTTCCACGTTGAAGCCTATGTTGGGAATGGTGGTCACGATCTCACCC
 
FO708CGTCTCCTTTGAGCTGTTTGChPPIA RT-PCR
FO709TTGACACTTCCTGGGACTGG
 
FO710CGTGTTTGCTGTGAAGACGGThARF1 RT-PCR
FO711ACGCTCTCTGTCATTGCTGT
 
FO712GAGGGAGCGGAGCGGAAChARF3 RT-PCR
FO713GCATTAGGCAGATCCTGTTTGTTTG
 
FO714TGCTTCTGCCCATCACAAGThARF4 RT-PCR
FO715AGCATCCAATCCAACCATCA
 
FO716ATGCGGATTCTCATGGTTGGhARF5 RT-PCR
FO717TCAGCAGATTCTTGGACCCG