TABLE 6

Primer and probe sequences for RT-PCRa

PathogenGene targetPrimer pairProbe5′ dye3′ quencher
Borrelia burgdorferiospAFwd: CCTTCAAGTACTCCAGATCCATTGCAACAGTAGACAAGCTTGA6-FAMMGB
Rev: AACAAAGACGGCAAGTACGATC
Borrelia miyamotoi/B. lonestariflaBFwd: AGCACAAGCTTCATGGACATTGATGTGGGTGCAAATCAGGATGAAGCAHEXBHQ-1
Rev: GAGCTGCTTGAGCACCTTCTC
Babesia microticox1Fwd: CATCATGCCAGGCCTGTTTGTACTACCCATACTGGTCGGTGCTCCQuasar 705BHQ-2
Rev: GAAGAAACCACAAGAGCAAATGC
Anaplasma phagocytophilum16S rRNAFwd: GGCATGTAGGCGGTTCGGTGCCAGGGCTTAACCCTGGAGCTCy5BHQ-2
Rev: CACTAGGAATTCCGCTATCCTCTCC
Powassan virus3′UTRFwd: GTGATGTGGCAGCGCACCCCTACTGCGGCAGCACACACAGTGTexas RedBHQ-2
Rev: CTGCGTCGGGAGCGACCA
Ehrlichia spp.16S rRNAFwd: CGTAAAGGGCACGTAGGTGGACTATCGAAAGAGGATAGCGGAVICMGB
Rev: CACCTCAGTGTCAGTATCGAACCA
Rickettsia spp.ompBFwd: AACAAGCTGCTGGGCACCATATAGAGAATGAGAAACCGTTAACGTFAMMGB
Rev: CGGTGCTGCTATCGGTATCACT
  • a UTR, untranslated region; 6FAM, 6-carboxyfluorescein; HEX, 6-carboxy-2,4,4,5,7,7-hexachlorofluorescein; BHQ, black hole quencher.