TABLE 7

Primer sequences and PCR conditions for qualitative assay

PathogenGene targetPrimer pairProduct length (nt)PCR conditions
Borrelia burgdorferiospAFwd: GCGTTTCAGTAGATTTGCCT67695°C for 10 min; 40 cycles of 95°C
for 30 s, 57°C for 30 s, and 72°C
for 60 s
Rev: TTGGTGCCATTTGAGTCGTA
Borrelia miyamotoi/
B. lonestari
flaBFwd: GGGATTATMAATCATAATACRTCAGC967 (B. miyamotoi)/
949 (B. lonestari)
95°C for 10 min; 40 cycles of 95°C
for 30 s, 57°C for 30 s, and
72°C for 70 s
Rev: TTGCTTGTGCAATCATAGCCATTGC
Babesia microti18S rRNAFwd: GGGACTTTGCGTTCATAAAACGC17195°C for 10 min; 40 cycles of 95°C
for 30 s, 60°C for 30 s, and
72°C for 45 s
Rev: GCAATAATCTATCCCCATCACGAT
Anaplasma
phagocytophilum
gltAPrimary reaction66895°C for 10 min; 40 cycles of 95°C
for 30 s, 62°C for 30 s, and
72°C for 60 s (same conditions for
primary and secondary reactions)
    Fwd: ACCGGAACCCCCATAGCTCT
    Rev: GCAAGTCGCATTGATCCGCT
Secondary reaction 589
    Fwd: TCGACATTTGGGTACAACTTGCG
    Rev: CAATTGCGAAAGTACCCGGCA
Powassan virusEnvelope (E)
glycoprotein
Fwd: GGCAACTGCATCTCTATRAATCC39595°C for 10 min; 40 cycles of 95°C
for 30 s, 58°C for 30 s, and
72°C for 45 s
Rev: CCTCATGCAGTGAAAATGGATATCTT
Ehrlichia spp.16S rRNAFwd: ATGCGTAGGAATCTACCTAGTAGTA460
Rev: GCCTTGGTATTTCACTTTTAACTTACT
Ehrlichia spp.gltAPrimary reaction77795°C for 10 min; 40 cycles of 95°C
for 30 s, 56°C (primary)/58°C
(secondary) for 30 s,
and 72°C for 60 s
    Fwd: CCAGGATTTATGTCTACTGCTGC
    Rev: GCATACYCTATGACCAAAMCCCAT
Secondary reaction627
    Fwd: GCGCGGATTACRTTTATTGATGG
    Rev: ATTGGCHCCACCATGAGCTG
Rickettsia spp.ompBFwd: GGTACTGCCGAGTTACGTTTAG38095°C for 10 min; 40 cycles of 95°C
for 30 s, 57°C for 30 s, and
72°C for 45 s
Rev: CTCGCATCAACAACRCCTG