TABLE 2

GRA15 primers used in this studya

GRA15 truncation or mutation5′→3′ primer
ForwardReverse
GRA1551–550CTC GAG ATAATTCGGTGGCTTGGGTATCTTGAA TTC TGGAGTTACCGCTGATTGTGTG
GRA1551–338GAA TTC TCA ATT TGA GTA CGT
TAA CCT CGC CTC CGT CTC
GRA1551–479GAA TTC TCA ATG CGG AGA CGA
GAT GGG TTG TGT ACG TGA
GRA1551–517GAA TTC TCA CTC AGT TGG TAC
AGA GTA GTA AGA GTT TTC
GRA1551–527GAA TTC TCA CCT TTG GGG ACC
TGG ATC AGA GAT CGT CCG
GRA1580–550CTC GAG TCC GAC TCA GTG CGG GAA
ACA CGG GAA ACA CGG CGA GGC
GRA15170–550CTC GAG GAC AGA AAA GTT CCG GAG
GGT GCC CAA CTC
GRA15270–550CTC GAG CCA ACG GCA CCA GCA CCA
GCG ACC GCC ACT AGC AAC
K/A1126CGTCAACCGATGGAGCGTCTGAGAGTGAACTGTCAGCGCCGCAGCCGCCGT
K/A172GTCCGAGAGACAGAGCAGTTCCGGAGGGTGTCGAAGAGCGTTCTTCCGCCGCCTTGC
ΔAAEECGCTCTTCGAGTCCGAGAGACAGAAAAGCTTGCGCGTCGCGAATGGGGAA
ΔSQQECTCCCTGTGGTAGAAAATGCGACTTTCTAGTGGAAGTTGGCTTTGCACGGC
  • a 5′ XhoI and 3′ EcoRI are in italic. The forward primer sequence common for all the C-terminal truncations and the reverse primer sequence common for all the N-terminal truncations are in boldface.