TABLE 2

Strains, plasmids, and primers used in this study

Strain, plasmid, or primerPropertiesReference or source
Strains
    E. coli
        S17-1 λpirgalU galK rpsL(Strr) endA1 nupG thi pro hsdR
hsdM+ recA (RP4-2 Tc::Mu Km::Tn7) λpir
25
        DH5αF ϕ80lacZΔM15 Δ(lacZYA-argF) U169 recA1
endA1 hsdR17(rK mK+) phoA supE44 λ thi-1
gyrA96 relA1
26
    P. aeruginosa
        Clinical isolatesaA007, A010, A014, A017, A018, A019, A024,
A026, A031, A032, A033, A034, A035, A037,
P003, P004, P006, P009, P010, P013, P015,
P016, P018, P020
Nottingham collection
        Null-R-pyocin mutants of clinical isolatesA014 ΔR, A018 ΔR, A026 ΔR, P003 ΔR, P013 ΔRThis study
        mCherry-tagged isolates containing pME6032-ptac::mCherryA026_mCherry, A018_mCherry, A026 ΔR_mCherry,
A018 ΔR_mCherry, P013_mCherry
This study
        GFP-tagged isolates containing pME6032-ptac::GFPA026_GFP, A018_GFP, A026 ΔR_GFP, A018
ΔR_GFP, P013_GFP
This study
Plasmids
    pME3087Suicide vector; ColE1 replicon, IncP-1, Mob; Tcr28
    pOO1pME3087 bearing construct gene with deletion of
PA020 and PA021 (pME3087::ΔPA0620-21); Tcr
This study
    pME6032-ptac::EGFPShuttle vector between E. coli and P. aeruginosa
containing lacIq-Ptac::EGFP; Tcr
Nottingham collection
    pME6032-ptac::mCherryShuttle vector between E. coli and P. aeruginosa
containing lacIq-Ptac::mCherry; Tcr
Nottingham collection
Primers (bp)b
    Gene amplification
        S1-F (518)TTCAACTCTACAACTGTCACGThis study
        S1-RTTCCATTTCCCTGTCGAGG
        S2-F (770)TTCGATGGTTATTACACATGTGCThis study
        S2-RAAGGCATTGTTTGCAGTCTGC
        S3-F (320)TGAATGGAGAAGAAGCTGATCGThis study
        S3-RTCTCTCGTCTCAAATGGTTTCC
        S4-F (236)AGAAGGCAATGGGAAGATGTGThis study
        S4-RAAGCATCTTCCTCTGTACTCTC
        S5-F (415)ATACGAGGTTCCCCCTATCGThis study
        S5-RAACAAGCTGCTGAAAAGGGTAC
        AP41-F (870)AATTGTCGATGGCGAACTGGThis study
        AP41-RATTGAAACACTGCCGACATCG
        R1-F (441)ATGATTTTTTTCCATGCCGCCACGThis study
        R1-RTCAGGGGGTGATGAGCGATTGG
        R2-F (257)ATGCCGATGCTTCGATTACThis study
        R2-RAAACCTCTCGCAAGGAGG
        R5-F (140)TGGAATCGTCAACCGCTCGCTGThis study
        R5-RTGGTGCTGACGCTGACATCTGC
    Null-R-pyocin mutant generation
        L-0619H3 (454)TCAAGCTTAGCCGACTGCTGCCGCCAAACThis study
        R-0619AGCCGATGCCGAACGGTCAGGTGTCTGCTC
        L-0622 (637)CGTTCGGCATCGGCTCGTCTATCTACCTGGThis study
        R-0622BHIATGGATCCCCACAGGCGATAGCCATCGTCG
  • a Listed are the 14 adult strains (A007 through A037) and 10 pediatric strains (P003 through P020).

  • b The size in base pairs for each primer pair is given in parentheses.