TABLEĀ 1

Primers used in this study

Primer namePrimer sequencePurposePCR
product
size
(bp)
0195-706/707s-IBSAAAAAAGCTTATAATTATCCTTAGGATTCGTGAAGGTGCGCCCAGATAGGGTGpJIR750_0195i construction350
0195-706/707s-EBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCGTGAAGTATAACTTACCTTT
CTTTGT
pJIR750_0195i construction
0195-706/707s-EBS2TGAACGCAAGTTTCTAATTTCGATTAATCCTCGATAGAGGAAAGTGTCTpJIR750_0195i construction
0195KOFCATAAAACAATTTCATCAGTAGCAGScreen for intron insertion in
cpr_0195
350
0195KORAAAACTCCACTTATAGCCAATAAAAScreen for intron insertion in
cpr_0195
1055-433/434s-IBSAAAAAAGCTTATAATTATCCTTAAATAACG-ATATAGTGCGCCCAGATAGGGTGpJIR750_1055i construction350
1055-433/434s-EBS1dCAGATTGTACAAATGTGGTGATAACAGATAAGTCGATATATTTAACTTACCTTT
CTTTGT
pJIR750_1055i construction
1055-433/434s-EBS2TGAACGCAAGTTTCTAATTTCGGTTTTATTCCGATAGAGGAAAGTGTCTpJIR750_1055i construction
1055FscreenCTTTTAATCATATTGACAGAAAAScreen for intron insertion in
cpr_1055
319
1055RscreenTTAGGATGGATTCTATCTAATTTTACScreen for intron insertion in
cpr_1055
0195compFCATCATGGATCCGATACATTTAATAATTCTGCAAATTCTTTAGACpJIR750_0195comp construction3,474
0195compRCATCATGGATCCGAGACAAAAGTAAGTTTTGATATACCpJIR750_0195comp construction
PJIR750ScreenCTGCAGGTCGACTCTAGAScreen for pJIR750_ 0195comp
in Strain 13
0195RT-FCAAAGAAATCTTTAGATGATTGCGART-PCR analysis of cpr_0195329
0195RT-RGATAGAAAACTTGGAGTTCATTTTGTAGRT-PCR analysis of cpr_0195
1055RT-FGCAAAGGTTTAAATGAGAGTTTTAGRT-PCR analysis of cpr_1055282
1055RT-RTATAGAATATATTCTCTGCTATTCCACRT-PCR analysis of cpr_1055
PolCFACTTCCCTGCAAGCCTCTTCTCCTRT-PCR analysis of polC393
PolCRTGGTTCAGCTTGTGAAGCAGGGCRT-PCR analysis of polC
rSpo0AHisFCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAAGGAAT
CAAAAATATCTGTAT
Cloning of spo0A gene for
recombinant expression
828
rSpo0AHisRGTGCTCGAGGCTAACTTTATTCTTTAGTCTTAATTTATCCloning of spo0A gene for
recombinant expression
r0195HisFCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAAATTA
CGACTAAAAACAAAAAAAG
Cloning of cpr_0195 gene for
recombinant expression
1,543
r0195HisRGTGCTCGAGATGTACTTCATAAATATCAGAAAGCTCCloning of cpr_0195 gene for
recombinant expression