TABLE 1 

PPMO sequences

Gene targetPPMO sequenceaVSV genome
target positions
N5′ GTAACAGACATTTTGATTACTGTT 3′51–74
P5′ GTGAGATTATCCATGATATCTGTT 3′1386–1409
M5′ GGAACTCATGATGAATGGATTGGG 3′2235–2258
G5′ GGCACTTCATGGTGTCAAGGAAAC 3′3064–3087
L5′ TCGTGGACTTCCATGATTGCTGTT 3′4723–4746
SCRc5′ AGTCTCGACTTGCTACCTCA 3′NAb
  • a Bases targeting the AUG translation start site are in boldface.

  • b NA, not applicable.

  • c Scrambled G.