TABLE 2 

Sequences of the primers and probes used in this study

Primer or probeSequenceaPurpose
Primers
    F2Rv0077cNde1CAGTCATATGTCGACGATCGACATTAGTGCCGFor cloning into pET24b(+)
    R20077cHindIIIGTCTAAGCTTCGTGCGCACCGCGACCGTCGACAACTGFor cloning into pET24b(+)
    F2Rv0078Nde1TAGTCATATGGAAATCAAGAGACGCACCCAGGAGFor cloning into pET24b(+)
    R20078HindIIIAATGAAGCTTGCCGTTAAGCATCCCGTCGATGAGFor cloning into pET24b(+)
    F3Rv00777cFISHTGACCCCCGCCTCGGTCGCGATTTCCGFor mutant mining of
Rv0077c::MycoMarT7
    F5Rv0077cNhe1TATCGCTAGCTGACCCCCGCCTCGGTCGCGATTTCCGRv0077c complementation
in M. tuberculosis in pMV306.strep
    R4Rv0077cHindIIIAGGTAAGCTTCTACGTGCGCACCGCGACCGTCGACAACTGRv0076c-Rv0077c complementation
in M. tuberculosis in pMV306.strep
    R4Rv0076cHindIIITAGTAAGCTTTCACAACGCTGCGGCGTGTTGGGTCRv0076c-Rv0077c complementation in
M. tuberculosis in pMV306.strep
    R2Rv00785RaceCCAGGCATCGACCGCTGCCCGG5′ RACE of Rv0078
    R2Rv0077c5RaceGCCGGTGTCGTTGCCGACCAGCA5′ RACE of Rv0077c
    R1Rv0077c5RaceGCGACGAGCTGGGTGACGAC5′ RACE of Rv0077c
    R1Rv00785RaceGGATCACCAGATACCTCGAG5′ RACE of Rv0078
    F5Rv0078Nhe1TATCGCTAGCGACCGGCGAGTCGCTCACTGACCCGTCGCCATAGRv0078 complementation in
pMV306.kan
    R5Rv0078HindIIICGGTAAGCTTCTAGCCGTTAAGCATCCCGTCGATGRv0078 complementation in
pMV306.kan
 
EMSA probes
    +74/+32AATGAATAGTTCCGGCACTAATGTCGATCGTCGACATGGATGCCCAGACCAGGGCAC
    +8/−25AGCAGACTGCCGGTAACTTACCAACAGATTGTACCAGACCAGGGCAC
    +19/−14 (WT)GTACATTTACAAGCAGACTGCCGGTAACTTACCCCAGACCAGGGCAC
    +19/−14 NS11GTACATGATAAAGCAGACTGCCTAGTGATAGTGCCAGACCAGGGCAC
    +19/−14 NS21GTACATGATAGTAGTAGTGATGATGATCTTACCCCAGACCAGGGCAC
    +19/−14 NS27GTACATGATAGTAGTAGTGATGATGATATAGTGCCAGACCAGGGCAC
    14merScafold5IRDye7005′-5IRD700-GTGCCCTGGTCTGG
  • a In the primer sequences, changes to the normal sequence are in boldface. In the probe sequences, the 14-nucleotide oligomers are underlined.