TABLE 4 

BLAST results for the DRs from the CRISPR array present in the genome of cyanophage N-1

Cyanobacterial stain (CRISPR ID)E valueStartEndDR consensus sequence
Microcoleus sp. strain PCC 7113 (CRISPR6)3.0e−0820870792087333GTCTGAATTCCATATAATCCCTATCAGGGATTGAAAC
Microcoleus sp. strain PCC 7113 (CRISPR11)1.0e−0731315053132053GTTTAAATTCCACTTAATCCCTATCAGGGATTGAAAC
Microcoleus sp. strain PCC 7113 (CRISPR15)1.0e−0738594583860565GTTTCAATCCCTGATAGGGATTAAGTGGAATTTAAAC
Microcoleus sp. strain PCC 7113 (CRISPR9)1.0e−0729162702917173GTTTAAATTCCACTTAATCCCTATCAGGGATTGAAAC
Nostoc sp. strain PCC 7107 (CRISPR27)1e−0758171075818597GTTGCAATTTCTATTAATCCCTATCAGGGATTGAAAC
A. variabilis ATCC 29413 (CRISPR3)8.0e−0712345561237182GTTTTAATTAACAAAAATCCCTATCAGGGATTGAAAC
Nostoc sp. strain PCC 7210 (CRISPR13)8.0e−0735168193517367GTTTCAATCCCTGATAGGGATTTTTGTTAGTTAAAAC
Nostoc sp. strain PCC 7210 (CRISPR14)8.0e−0735175423518084GTTTCAATCCCTGATAGGGATTTTTGTTAGTTAAAAC
A. cylindrica PCC 7122 (CRISPR21)4e−0750010365003639GTTTCAATCCCTAATAGGGATTATTTGAAATTTCAAC
C. stagnale PCC 7417(CRISPR5)4e−0711015021103134GTTACAATTCACCCAAATCCCTATCAGGGATTGAAAC
Calothrix sp. strain PCC 6303 (CRISPR6)4e−0720218642022765GTTCCTATAAACTAAAATCCCTATCAGGGATTGAAAC
Calothrix sp. strain PCC 6303 (CRISPR8)4e−0720380852039287GTTCCTATAAACTAAAATCCCTATCAGGGATTGAAAC
Calothrix sp. strain PCC 7507 (CRISPR24)4e−0750674215070798GTTTCAATCCCTGATAGGGATTTAAGTTAATTGGAAC
Calothrix sp. strain PCC 7507 (CRISPR14)4e−0733750253376306GTTTCAATCCCTGATAGGGATTTAAGTTAATTGGAAC
N. punctiforme PCC 73102 (CRISPR16)3.0e−0733381723341197GTTTCAATCCCTGATAGGGATTTTGATGAATTGCAAT
Nostoc sp. strain PCC 7210 (CRISPRS8)3.0e−0718368131837723GTTTCTATTAACACAAATCCCTATCAGGGATTGAAAC
Nostoc sp. strain PCC 7210 (CRISPRS3)3.0e−07807452807558ATTGCAATTAACTAAAATCCCTATCAGGGATTGAAAC
A. variabilis ATCC 29413 (CRISPR19)3.0e−0757640105766428ATTGCAATTAACTAAAATCCCTATCAGGGATTGAAAC
Nostoc sp. strain PCC 7210 (CRISPRS20)3.0e−0756541335654384GTTAAAACCCTCTAAAATCCCTATCAGGGATTGAAAC
A. variabilis ATCC 29413 (CRISPR9)3.0e−0723956702398703GTTTCAATCCCTGATAGGGATTTTAGAGGGTTTTAAC
A. variabilis ATCC 29413 (CRISPR18)1.0e−0652272135229282GTTTCTATTAACACAAATCCCTATCAGGGATTGAAAG
Cyanothece sp. strain PCC 7424 (CRISPR26)4.0e−0635751243575742GTTACAATTAAAATGAATCCCTATTAGGGATTGAAAC
A. variabilis ATCC 29413 (CRISPR16)4.0e−0648212504823752GTTGCAACACCACATAATCCCTATTAGGGATTGAAAC