TABLE 1 

Primers used in the present study

Primer nameSequence (5′→3′)aResearch objective
TGME49_286470-
5UTR_F
TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACCACGAACTAGACATAGACAGAGCCTKO vector
TGME49_286470-
5UTR_R
GCGGGTTTGAATGCAAGGTTTCGTGCTGATCAAACTAGTCCAGTGGCCTGTCCCTGATGCACATKO vector
TGME49_286470-
3UTR_F
TTCTGGCAGGCTACAGTGACACCGCGGTGGAGGACTAGTTGAGCGCAAGGTGGTAGGCAGGTCTKO vector
TGME49_286470-
3UTR_R
GTGAGCGGATAACAATTTCACACAGGAAACAGCGAAGCGCATACGAGCAAAGAGGAGTCKO vector
KO_FAGAGAAGACCTCTCGCCAAGKO check
KO_RACTGCGAACAGCAGCAAGATKO check
WT_FAGAGGAATAGACGGGAAAGAWT check
WT_RGAATGGGTTGGTGGATGAGAWT check
COMP_FTGATTACGCCAAGCTCGGAAAGAGAAGACCTCTCGCCAAGComplement vector, complement check
CDS_RCGTCGTACGGGTACCTAAAATTGTCGAAGAAGGCCTGCTGComplement vector
pLIC-3HA-FAGGTACCCGTACGACGTCComplement vector
pLIC-3HA-RTTCCGAGCTTGGCGTAATCAComplement vector
COMP_RCACCACTTCTCGTACTATGGCComplement check
  • a Underlined sequences were used for ligation-independent cloning.