TABLE 4 

Bacterial strains, plasmids, and primers used in this study

Bacterial strain, plasmid, or primerCharacteristic(s) or sequenceReference or sourceCommenta
S. aureus strains
    USA300 HoustonCommunity-associated MRSA clinical isolate26
    SH1000Laboratory strain; rsbU functional29
    UAMS-1Osteomyelitis clinical isolate30
    RN4220Restriction-deficient transformation recipient31
    AW2192USA300 pMK4::teg23p-his6This study
E. coli strain
    DH5αRoutine cloning strainInvitrogen
Plasmids
    pMK4Shuttle vector; Cmr32
    pAW105pMK4::teg23P-his6This study
Primers
    OL11845′ TCTGGACCGTGTCTCAGTTCC 3′27
    OL11855′ AGCCGACCTGAGAGGGTGA 3′27
    OL27015′ CCAAATTTAGGCATGTCAAATCGGC 3′teg23 probe
    OL32015′ GGATTCCCAATTTCTACAGACAATGCA 3′tsr8 probe
    OL32085′ ACGGGCATATAAAAGGGGAATATTTGAAAA 3′tsr25 probe
    OU01215′ GTGTTAAAAAAATAACTGGGATGTG 3′tsr26 probe
    OL32165′ CTCACAAATTCTGTAAGGGGAGCGTAT 3′tsr31 probe
    OL32175′ TTATGTCCCAATGCTGAATAAATAACTTC 3′tsr33 probe
    OL32225′ ACGCGTCGACGCGCTTGTATTCGCTGCAGG 3′teg23P F
    OL32235′ CGGGATCCTTAGTGGTGGTGGTGGTGGTGCGCCAACAAGGTTTCAAGAGC 3′teg23P-his6 R
    OL32325′ CGCCAACAAGGTTTCAAGAGC 3′teg23 OL1
    OL32815′ TAAACAACATACAGCCATTG 3′teg23 OL2
    OL32825′ GAGAATTTGAAGGCAAGTAT 3′teg23 OL3
    OL38805′ GCCAGGATAATGTAGTCTTAA 3′tsr1 F
    OL38825′ CCATTAATTTACTCAAACCG 3′tsr1 R
    OL38855′ GCTTCTGTTCGATCTC 3′tsr2 F
    OL38865′ CACGTCTTCTGATTAAAC 3′tsr2 R
    OL39165′ CATACCTCTTTAACAACAG 3′tsr18 F
    OL39175′ GGAGGAATTAATCATGTC 3′tsr18 R
    OL39355′ GAAGGGATCCAACACA 3′tsr24 F
    OL39375′ GTCTCGCCATTAATACTAC 3′tsr24 R
    OL39465′ GTCTTTTCACAACCAAAG 3′tsr29 F
    OL39485′ GGTTTTATCTTTGGAAAAAG 3′tsr29 R
    OL39565′ GATGCGGAAAATTTGG 3′tsr32 F
    OL39575′ GTGCGCAATGAATATTATG 3′tsr32 R
  • a F, forward; R, reverse.