TABLE 2 

AkgR and other binding sites across the R. sphaeroides genome identified by ChIP-seq

Binding siteNo.Gene IDAnnotationaChrIDChIP FCbMotif startPredicted sequencecRegd
AkgR targets1RSP_0967-2sucCDABchr157.82730051GTGATCACGGGCTCGAAGGGTGTGATCAC+
2RSP_0974-9Succinate dehydrogenase complex (sdh)chr184.42734855GTGATCACAGGCCCGCATCTTGTGATCAC+
Other3RSP_171850S ribosomal protein L23chr16.7309349
4RSP_3523ABC peptide transporterchr23.8603190GTGATCAC
5RSP_2434Putative MCP methyltransferase CheR1chr141067862GTGATCAC
6RSP_0386Cold-shock DNA-binding domain proteinchr12.82119408GTGATCAC
7chr17.8950186GTTATCAC
8chr23.1588319GTGATCAC
9chr12.93136550GTGATCAC
  • a Binding sites not found ≤500 bp upstream of the start codon of an annotated gene were not assigned to any operon.

  • b ChIP FC, ChIP-seq fold change (the fold enrichment of the CceR binding at target promoters relative to mock anti-myc ChIP control).

  • c Bold letters indicate the most conserved bases in the proposed AkgR binding site.

  • d Regulatory role of AkgR on target operon based on gene expression analysis. +, activation. No entry indicates that the genes were not observed to be differentially expressed under the conditions tested.