TABLE 2 

DNA sequences of primers used for qPCR analysis

Gene productPrimer sequence (from Integrated DNA Technologies)a
Sirtuin 1Fwd: 5′ ACAGGTTGCGGGAATCCAAAGG 3′
Rev: 5′ CCTAGGACATCGAGGAACTACCTG 3′
Sirtuin 2Fwd: 5′ ACCCGCTAAGCTGGATGAAAGAG 3′
Rev: 5′ AGTCTTCACACTTGGGCGTCAC 3′
Sirtuin 3Fwd: 5′ ACATCGATGGGCTTGAGAGAGTG 3′
Rev: 5′ CAGAGGCAAAGGTTCCATGAGC 3′
Sirtuin 4Fwd: 5′ ACAGGGTCCTGTGCTTGGATTG 3′
Rev: 5′ CTTGGAAACGCTCTTGCAGCAC 3′
Sirtuin 5Fwd: 5′ TGGCTCGGCCAAGTTCAAGTATG 3′
Rev: 5′ AAGGTCGGAACACCACTTTCTGC 3′
Sirtuin 6Fwd: 5′ TGTGGAAGAATGTGCCAAGT 3′
Rev: 5′ CTTAGCCACGGTGCAGAG 3′
Sirtuin 7Fwd: 5′ GCGTCTATCCCAGACTACCG 3′
Rev: 5′ GTGATGCTCATGTGGGTGA 3′
GAPDHFwd: 5′ CGACAGTCAGCCGCATCTTT 3′
Rev: 5 ′ GGCAACAATATCCACTTTACCAGAG 3′
β-ActinFwd: 5′ TCCTCCTGAGCGCAAGTACTC 3′
Rev: 5′ CGGACTCGTCATACTCCTGCTT 3′
CobBFwd: 5′ ATGCCATTGTTGCCAGTTTCCG 3′
Rev: 5′ ATCCATGCCGAGTGGCATTTCG 3′
CysGFwd: 5′ TTGTCGGCGGTGGTGATGTC 3′
Rev: 5′ ATGCGGTGAACTGTGGAATAAACG 3′
  • a Fwd, forward; Rev, reverse.