TABLE 1 

siRNAs used in this studya

siRNASequence (sense) (from Sigma) or description
siSirt1_15′ CUGUGAAGCUGUACGAGGA [dT][dT] 3′
siSirt1_25′ GAAGUACAAACUUCUAGGA [dT][dT] 3′
siSirt2_15′ CUACUCCUGCGCUGCUACA [dT][dT] 3′
siSirt2_25′ CGCGUUUCUUCUCCUGUAU [dT][dT] 3′
siSirt3_15′ CUCAAAGCUGGUUGAAGCU [dT][dT] 3′
siSirt3_25′ GACAAGACCUCAUGCCUGA [dT][dT] 3′
siSirt4_15′ GGGAUCAUCCUUGCAGGUA [dT][dT] 3′
siSirt4_25′ CUUUGAGCACCUGGGAGAA [dT][dT] 3′
siSirt5_15′ CAGCAUCCCAGUUGAGAAA [dT][dT] 3′
siSirt5_25′ GAGAUCCAUGGUAGCUUAU [dT][dT] 3′
siSirt6_15′ CUGUCCAUCACGCUGGGUA [dT][dT] 3′
siSirt6_25′ CUCACUUUGUUACUUGUUU [dT][dT] 3′
siSirt7_15′ GGGAGUACGUGCGGGUGUU [dT][dT] 3′
siSirt7_25′ CCCUGAAGCUACAUGGGAA [dT][dT] 3′
siIE25′ AAACGCAUCUCCGAGUUGGAC [dT][dT] 3′
siNTsiRNA universal negative control 1 (Sigma)
  • a DNA bases within RNA oligonucleotides are shown in brackets.