TABLE 1 

Primers and expression constructs

Primer or expression constructPrimer sequence or construct description and primers used
Primers
    ETX-ForwardCATCAGAATTCGATGACGATGACAAGAAAGCTTCTTATGATAATGTAGATAC
    ETX-262ReverseCATCATGGATCCTTAATTTGTATTTAAATTTCTAACCTTAACT
    ETX-263ReverseCATCATGGATCCTTAATTATTTGTATTTAAATTTCTAACCTTA
    ETX-264ReverseCATCATGGATCCTTATACAATAATTGTATTTAAATTTCTAACC
    ETX-267ReverseCATCATGGATCCTTAATATTCTTGTACATTATTTGTATTTAAATTTC
    ETX-273ReverseGACCATGGATCCTTATTTTTTATCTACAGGTATTACATATTC
    ETX-296ReverseTTTGGATCCTTATTTTATTCCTGGTGCCTTAATAG
Constructs
    ETX-14/262N-terminal site of trypsin activation to Asn262, ETX-Forward/ETX-262Reverse
    ETX-14/263N-terminal site of trypsin activation to Asn263, ETX-Forward/ETX-263Reverse
    ETX-14/264N-terminal site of trypsin activation to Val264, ETX-Forward/ETX-264Reverse
    ETX-14/267N-terminal site of trypsin activation to Tyr267, ETX-Forward/ETX-267Reverse
    ETX-14/273N-terminal site of trypsin activation to Lys273, ETX-Forward/ETX-273Reverse
    ETX-14/296N-terminal site of trypsin activation to Lys296, ETX-Forward/ETX-296Reverse