TABLE 3 

Primers used in this study

PrimerSequence (5′→3′)
RH1451aTTCGGTGGATCCACCCAGATACGGCTGATGTC
RH1452aCACACGGGATCCTTCGTTCCTGGTCGATTTTC
RH1453TCGATAGATTGTCGCACCTG
RH1454CTGCCTCGGTGAGTTTTCTC
RH1456bGTGGCACATGCTTGAAACCTACGTGAAG
RH1457bCTTCACGTAGGTTTCAAGCATGTGCCAC
RH1458cCAACGTGATTCTATGCGATCATGG
RH1459cCCATGATCGCATAGAATCACGTTG
RH1471CCGCTCCAAAAACTATCCAC
RH1472ATCGGAAATGGTTGTGAAGC
RH1476bGATTCATCAACACGTTGAAAGCGCCGCC
RH1477bGGCGGGCGCTTTCAACGTGTTGATGAATC
aphA1-FCAACGGGAAACGTCTTGCTC
aphA1-RATTCGTGATTGCGCCTGAG
  • a Underlined sequence indicates BamHI restriction site incorporated into the 5′ end of the primer.

  • b Bold sequence denotes modification to the template sequence to introduce a D→L amino acid substitution.

  • c Bold sequence denotes modification to the template sequence to introduce an E→L amino acid substitution.