TABLE 1 

Numbers of mutations detected at the potential off-target cleavage sites in the Plasmodium yoelii genome

sgRNASequenceaNo. of mismatchesChromosome locationbMutation
Pysera 1 targeting sgRNA1GTACCGGGAAACTCTGATCAAGGNone
ACAAAAGCACTTTCTGATCAAGG913: 2055967−2056749(−)None detected
GATATTGAAAAATCTGATCATGG710: 899397−901846(−)None detected
ATTTTAAAAAATTCTGATCATGG810: 1255700−1258432(−)None detected
PY03652 targeting sgRNAGTCTTTATGTGGGTAACTTAAGGNone
TTAAATAATATTGTAACTTATGG904: 309670−311468(+)None detected
TTTTCTATTTCTGTAACTTTAGG711: 790345−792444(+)None detected
TTAAATTTTTTCGTAACTTTTGG904: 529947−530873(−)None detected
GTTTTTTCACTAGTAACTTGGGG804: 995696−1000093(−)None detected
ATGTTTTTTTCAGTAACTCCGGG811: 1701710−1706203(−)None detected
  • a Nucleotides in bold type are mismatches between the sgRNA sequences and the potential off-target sites. Underlined nucleotides are nucleotides in the protospacer adjacent motif (PAM) following the 20-nt sgRNA targeting sequence.

  • b The chromosome number is shown before the colon. The numbers after the colon are the positions on the chromosome. Minus and plus symbols in parentheses indicate the forward or reverse strand of genome DNA, respectively.