TABLE 1 

List of primers used to generate pYUB1471

Primer namePrimer sequencea
pJSC347HLTTTTTTTTCCATGAATTGGCAGGTCCTGTATCCTAAATC
pJSC347HRTTTTTTTTCCATTCTTTGGCTAGAGTCCTGTCCGAAATA.
pJSC34OLTTTTTTTTCCATAAGTTGGCAGGTTTGACAGCTTATCCAT
pJSC34ORTTTTTTTTCCATTTTTTGGAGTGAGTCGTATTACGATCCT
0004LLTTTTTTT CCATAAATTGGCCGCACCGTGACGACCTAA
0004LRTTTTTTTTCCATTTCTTGGAGCGGTTGTGGATCACGAATG
0004RLTTTTTTTTCCATAGATTGGCGCGACACCTACGGATAACA
0004RRTTTTTTTT CCATCTTTTGGGCGTTCACTTGCCGACTT
sacBLTTTTTTTTCACGCGGTGCTTTTTAACCCATCACATATAACC
sacBRTTTTTTTTCAGCGCCTGAGATCGGCATTTTCTTTTGCGTT
  • a The variable overhangs in the Van91I recognition sequences at primer ends are in bold.