TABLE 1 

Inactivation of UPRT by CRISPR/CAS9-mediated mutagenesis

sgRNA targetExpt% GFP-
positive cellsa
Plaque formationb% efficiencyc
Without FUDRWith FUDR
UPRT141.092/200122/6,00011.0
226.573/20065/6,00011.3
321.670/20039/6,0008.6
ROP18127.493/2000/600,0000.0
224.467/2000/600,0000.0
319.871/2000/600,0000.0
UPRT-OT1d127.640/2001/600,0000.003
223.963/2000/600,0000.0
UPRT-OT2e116.757/2006/600,0000.021
220.067/20012/600,0000.050
  • a The CAS9-GFP expressing population was estimated by immunofluorescence staining 24 h posttransfection.

  • b Number of plaques observed/number of parasites seeded. When applied, FUDR was used at 10 µM.

  • c [(Number of plaques observed in the presence of FUDR/% GFP-positive cells)/number of plaques observed in the absence of FUDR] × 100.

  • d The sgRNA sequence GGCGTCTCGATTGTGAGACG differs from the UPRT sgRNA sequence by two nucleotides (bold).

  • e The gRNA sequence GGCGTCTCGATTGTGAAGGC differs from the UPRT sgRNA sequence by two nucleotides (bold).