TABLE 2 

Bacterial strains, plasmids, and oligonucleotide primers used in this study

Bacterial strain, plasmid, or
oligonucleotide primer
Description (genotype and/or relevant characteristicsa)
or sequence of oligonucleotide primerb
Reference or source
Bacterial strains
    P. protegens
        LK099Wild-type Pf-549
        LK1476-fold mutant; contains mutations in hcnB, ofaA, phlA, pltA, prnC, and rzxB of strain Pf-5
described below; HCN Ofa DAPG MAPG Plt Prn Rzx
35
        JL4909ΔhcnB mutant; contains a 239-bp deletion in hcnB of Pf-5; HCN52
        JL4807ΔofaA mutant; contains 1,143-bp deletion in ofaA (PFL_2145) of Pf-5; contains FRT scar
in deleted ofaA frame; Ofa
15
        LK023ΔphlA mutant; contains a 639-bp deletion in phlA (PFL_5954) of Pf-5; MAPG DAPG36
        JL4805ΔpltA mutant; contains a 275-bp deletion in pltA (PFL_2787) of Pf-5; Plt60
        LK415pltA+ complemented mutant; contains a wild-type pltA gene replacing the mutated pltA
in the chromosome of strain JL4805; Plt+
This study
        JL4793ΔprnC mutant; contains an 86-bp insertion of FRT site in prnC (PFL_3606) of Pf-5; Prn60
        JL4808ΔrzxB mutant; contains a 1,342-bp deletion in rzxB (PFL_2989) of Pf-5; Rzx60
        LK298pltR* mutant; contains codon-modified pltR (PFL_2785) in the chromosome of Pf-5;
overexpresses plt biosynthesis genes and overproduces pyoluteorin
11
        LK417pltR* ΔpltA double mutant; contains a 275-bp deletion in pltA and the codon-modified
pltR* in the chromosome of Pf-5; overexpresses plt biosynthesis genes; Plt
This study
        JL4975ΔgacA mutant; contains a 612-bp deletion in gacA (PFL_3563) of Pf-5; altered in the
secondary metabolism and many other phenotypes regulated by GacA
60
    P. fluorescens SS101Wild-type strain57
    P. aeruginosa PAO1Wild-type strain58
    P. chlororaphis 30-84Wild-type strain50
    B. subtilis 168Wild-type strain61
Plasmids
    pEX18Tc 168Gene replacement vector with MCS from pUC18; sacB+ Tcr62
    P18Tc-pltApEX18Tc containing wild-type pltA in a 1,359-bp BamHI fragmentThis study
    ppltL-gfppPROBE′-gfp (tagless) contains the intergenic region between pltR and pltL, including
the promoter of pltL fused with a promoterless gfp
11
    pEX18km-pltR-MCod3pEX18Km with a 1,160-bp synthesized DNA fragment, containing pltR of Pf-5 with
modifications in 35 types of rare codons
11
Oligonucleotide primers
    plt UpF-BamGTGTGGTAGTGGATCCTCCAGGACTGTCGAGCAAC
    plt DnR-BamGCAGAAGAGAGGATCCTACTTGTGCCAGAGGTGTTC
    gacA-seqFCGGTCTTGCGGAAATAGCTG
    gacA-seqRTAGGACCGTTATTGCGCCC
    gacS-5’FCCAAGATCAGCCCCCGGCAA
    gacS-Reverse (1)ATCCAGCTCCTGGCTGCCCA
    gacS-Middle Forward (2)GCCGCACAATCAACAACCCGC
    gacS-Middle Reverse (2)GCGCAGTTGCACGCTGTCTT
    gacS-Middle Forward (3)CGCTGCGGCTCAAGCAGATTC
    gacS-Middle Reverse (3)TCGACACACAGCACTCGCGG
    gacS-Forward (1)CAGCCAGTTGCAGGCCAAGC
    gacS-3’RAGCGCCGAGGAAACTCTCGC
  • a Ofa, orfamide A; DAPG, 2,4-diacetylphloroglucinol; MAPG, monoacetylphloroglucinol; Plt, pyoluteorin; Prn, pyrrolnitrin; Rzx, rhizoxin analogs; HCN, hydrogen cyanide; Tox, toxoflavin; Smr, streptomycin resistance; Tpr, trimethoprim resistance; Tcr, tetracycline resistance; Kmr, kanamycin resistance; MCS, multiple-cloning site.

  • b Restriction sites used for cloning are underlined in oligonucleotide primer sequences.