Article Figures & Data
Figures
- FIG 1
Fluid-like properties of the non-membrane-associated VSV replication compartment. (a) Composite phase-contrast and laser micrograph of Vero cells infected with rVSV-eGFP-P 6 h postinfection (6 hpi). Scale bar, 10 µm. (b) Electron micrograph of rVSV-eGFP-P-infected Vero cells (6 hpi) showing electron-dense inclusion (I), mitochondrion (M), and cytoplasm (C). Scale bar, 0.5 µm. (c and d) Time-lapse GFP images (Movie 1) showing fusion (c) and fission (d) of viral inclusions in rVSV-eGFP-P-infected Vero cells (6 hpi). Arrow marks the clearly separated inclusion. Single-plane GFP fluorescence micrographs were captured every 30 s. Scale bars, 5 µm. (e) Phase-separated compartments form in cells from a diverse range of hosts. Shown are fluorescence micrographs of the following cell lines infected with rVSV-eGFP-P and counterstained for DNA: Homo sapiens HeLa S3 (6 hpi), Chlorocebus aethiops Vero (6 hpi), Mus musculus mouse embryonic fibroblast (8 hpi), Xenopus laevis S3 (8 hpi), Aedes albopictus C6-36 (48 hpi), and Spodoptera frugiperda Sf-9 cells (48 hpi). Scale bars, 10 µm.
- FIG 2
Replication compartment formation and maintenance are insensitive to microtubule depolymerization. (a) GFP fluorescence micrographs of Vero cells cultured in medium alone (mock treatment) or supplemented with nocodazole and fixed at 3 or 6 hpi with rVSV-eGFP-P. Cell nuclei are outlined for reference (dotted lines). Scale bar, 10 µm. (b) Time course for the appearance of eGFP in cytosol and viroplasm in Vero cells after infection with rVSV-eGFP-P and culture in medium alone (mock treatment) or supplemented with nocodazole. (c) Time-lapse GFP images (Movie S2) of fusion between viral inclusions in nocodazole-treated Vero cells infected with rVSV-eGFP-P and imaged every minute. Scale bar, 5 µm.
- FIG 3
Rapid exchange of the components of the replication compartments. (a) Time-lapse images and quantification of FRAP experiments in Vero cells infected with rVSV-eGFP-P (filled circles) or transfected with a cDNA encoding G250-GFP (filled squares). The photobleached region (solid line box) and regions used for quantification (dotted line boxes) are indicated. Scale bars, 5 µm. (b) Time-lapse images and quantification of whole-inclusion FRAP in Vero cells infected with rVSV-eGFP-P. Integrated fluorescence intensity over time was fit to a single-exponential recovery curve for representative inclusions from mock-treated (black; t = 0.010 s−1; R2 = 0.979) or nocodazole-treated (red; t = 006 s−1; R2 = 0.993) cells. Scale bars, 2 µm. (c) FRAP recovery half-lives for inclusions in mock-treated (5 cells; mean, 68 s; standard deviation [SD], 11 s) and nocodazole-treated (10 cells; mean, 83 s; SD, 41 s) had no significant difference (unpaired t test, P = 0.3).
- FIG 4
Viral replication proteins, but not replication, are required to form viroplasm in cells. (a) Representative images showing the effects on inclusion morphology in Vero cells treated with puromycin or the indicated PPMO for 3 h: VSV-L (green), VSV-N (red), and DNA (blue). Scale bar, 10 µm. (b) Classification of VSV-N and VSV-L protein staining patterns in VSV-infected Vero cells after PPMO treatment. The total cell count is indicated for each treatment. (c and d) Representative live eGFP fluorescence images of cells transfected with cDNA encoding eGFP-P (c) or L-eGFP (d). Scale bars, 10 µm. (e) Single-plane, time-lapse imaging (2 frames min−1) of inclusions in Vero cells transfected with the indicated plasmid cDNA encoding (N) eGFP-P and catalytically inactive L. Scale bar, 5 µm.
Tables
- TABLE 1
PPMO sequences
Gene target PPMO sequencea VSV genome
target positionsN 5′ GTAACAGACATTTTGATTACTGTT 3′ 51–74 P 5′ GTGAGATTATCCATGATATCTGTT 3′ 1386–1409 M 5′ GGAACTCATGATGAATGGATTGGG 3′ 2235–2258 G 5′ GGCACTTCATGGTGTCAAGGAAAC 3′ 3064–3087 L 5′ TCGTGGACTTCCATGATTGCTGTT 3′ 4723–4746 SCRc 5′ AGTCTCGACTTGCTACCTCA 3′ NAb
MOVIE S1
Dynamics of VSV inclusions. Shown is a 3D maximum-intensity projection of Vero cells 4 hpi with rVSV-eGFP-P and imaged for 30 min (2 frames per min). Inclusions exhibit vigorous movement throughout the cytoplasm and frequently undergo fusion and fission events. Download MOVIE S1, MOV file, 3.9 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
MOVIE S2
Dynamics of VSV inclusions in nocodazole-treated cells. Shown is a 3D maximum-intensity projection of Vero cells infected with rVSV-eGFP-P (4 hpi) and treated with nocodazole 1 h before imaging. Cells were imaged for 30 min (2 frames per min). Inclusions appear as rounded droplets that are generally still but retain the ability to undergo fusion. Download MOVIE S2, MOV file, 3.1 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
FIG S1
L and P display rapid but distinct FRAP kinetics in viroplasm. (a) Visualization of RFP-P and eGFP-L images of an inclusion in Vero cells infected with rVSV (RFP-P and L-eGFP) before and after photobleaching (box). Scale bar, 5 µm. FRAP for RFP-P (filled circles) and eGFP-L (open circles) were measured as a pixel average (between short lines 0.5 µm from the bleach front) and fit to a recovery curve with single-exponential (RFP, 62%, t = 0.83 s−1; eGFP, 15%, t = 0.45 s−1) and linear (RFP, 38%, mean, 0.04 s−1; eGFP, 85%, mean, 0.04 s−1) components. R = 0.986 and 0.995 for eGFP and RFP, respectively. (b) FRAP quantification of L-eGFP and RFP-P in viroplasm. Download FIG S1, TIF file, 0.8 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
MOVIE S3
Rapid exchange of eGFP-P in viral inclusions. Shown is partial photobleaching of a viral inclusion in Vero cells infected with rVSV-eGFP-P (4 hpi). Cells were imaged 3 frames before and 45 frames after photobleaching (28 frames per s). Rapid FRAP was observed on the right half of the inclusion. Download MOVIE S3, MOV file, 0.1 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
MOVIE S4
No exchange of fluorescent proteins in Vero cell aggresomes. Shown is photobleaching of the perinuclear inclusion in a Vero cell formed by cDNA expression of G250. Cells were imaged for 3 frames before and 148 frames after photobleaching (28 frames per s). No FRAP was observed. Download MOVIE S4, MOV file, 0.6 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
FIG S2
Mixing of replication compartments following fusion of cells separately infected with rVSV-eGFP-P or rVSV-RFP-P. Syncytia were generated by fusion of Vero cells infected with either rVSV-eGFP-P (green) or rVSV-RFP-P (red) fused in the absence (upper panels) or presence (lower panels) of nocodazole to depolymerize microtubules. Yellow inclusions indicate mixed protein populations of eGFP-P and RFP-P. Cells were additionally stained for cell boundaries (WGA; wheat germ agglutinin) and nuclei (blue). Scale bars, 10 µm. Download FIG S2, TIF file, 1.2 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
MOVIE S5
Inclusions containing both RFP-P- and eGFP-P-tagged proteins following simultaneous coinfection with rVSV-RFP-P and rVSV-eGFP-P virus. Shown is a 2D time-lapse movie of a Vero cell coinfected with rVSV-RFP-P and rVSV-eGFP-P viruses at 5 h postinfection. Inclusions containing a mixture of RFP-P- and GFP-P-tagged proteins (yellow) are observed. Inclusions are seen to undergo frequent fission and fusion events that contribute to the mixing of their content. Frame rate = 10 fps. Scale bar = 10 µm. Download MOVIE S5, MOV file, 1.7 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
FIG S3
Specific block of viral protein synthesis using PPMOs targeted to each viral mRNA. Shown are autoradiograms of cell lysates from Vero cells treated 4 hpi with the indicated PPMO and labeled with [35S]MetCys for 3 h. Download FIG S3, TIF file, 0.8 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
FIG S4
Expression of viral N, P, and L proteins is sufficient for formation of a phase-separated compartment. Shown are representative images of cells expressing viral (a) eGFP-tagged P, (b) N, or (c) L protein. N and eGFP-P are distributed throughout the cytoplasm when expressed alone, while L forms large aggregate-like structures. Scale bars, 10 µm. (d) Colocalization (yellow) of eGFP-tagged P (green) and L (red) when coexpressed. (e) Formation of inclusion-like structures in cells coexpressing N (red), L (blue), and P. Colocalization of N and L is shown. GFP expression (green) from a negative-sense RNA replicon construct encoding GFP (green) demonstrates active ongoing viral replication and the presence of all three viral replication proteins. Scale bar, 5 µm. Download FIG S4, TIF file, 1.1 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
MOVIE S6
Fluid inclusions are formed in Vero cells when N, eGFP-P, and L are coexpressed following cDNA transfection. A 3D time-lapse movie of a Vero cell transfected with N, eGFP-P, and L polymerase displays dynamic structures that are capable of fusion. Download MOVIE S6, MOV file, 2.8 MB.
Copyright © 2018 Heinrich et al.
This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.
