Article Figures & Data
- FIG 1
Northern blot analysis of tsr transcripts. Northern blotting was performed using oligonucleotide probes specific for the tsr transcripts (tsr8, tsr25, tsr26, tsr31, and tsr33). RNA-seq read alignments for each corresponding chromosomal location are shown, as are CDS genes (black arrows), and sRNAs (red arrows). The depth of read coverage on the genome is shown by the blue histograms.
- FIG 2
Variation in genome annotation of the tsr12 locus. RNA-seq read alignment data are shown for strains USA300 (A), MRSA252 (B), and NCTC 8325 (C). Annotations for CDS genes are shown by black arrows, and the depth of coverage is shown by the blue histograms. The location of tsr12 is shown by a red arrow. (A) There is no CDS annotation at the tsr12 locus in strain USA300. (B) In strain MRSA252, a gene (SAR0432) is annotated in the forward direction at the tsr12 locus. (C) In strain NCTC 8325, a gene (SAOUHSC_00396) is annotated in the reverse direction at the tsr12 locus.
- FIG 3
Analysis of the Teg23 locus. (A) Teg23 locus in S. aureus strains N315, USA300, NCTC 8325, and MRSA252. Annotated CDS genes are shown in gray. The previously reported location of Teg23 is shown in white. (B) Northern blot analysis of Teg23. The Teg23 transcript was detected by Northern blot analysis with a strand-specific oligonucleotide probe. Two bands were detected and were designated Teg23.1 (approximately 215 nt) and Teg23.2 (approximately 310 nt). (C) Alignment of Teg23 DNA sequence in strains USA300, NCTC 8325, and MRSA252. Sequence corresponding to the SAOUHSC_02572 and SAR2384 CDS genes is highlighted in red and blue, respectively. Sequence potentially encoding an 80-amino-acid protein (Teg23P) in strain USA300 is highlighted in green. (D) Western blot to detect histidine-tagged Teg23P. No Teg23P protein was detected in S. aureus expressing the Teg23P-his plasmid (lane 1) or in a wild-type S. aureus strain without the plasmid (lane 2). Histidine-tagged RpoE was detected as a positive control (lane 3). (E) Quantitative RT-PCR analysis of Teg23 expression. Expression of Teg23 was analyzed in the wild-type S. aureus strain with or without the Teg23P-his plasmid. Approximately 3-fold-higher expression of Teg23 was detected in the strain expressing the Teg23P-his plasmid. Statistical significance was determined using Student's t-test. *, P < 0.05. (F) RNA-seq read alignment at the Teg23 locus in strain NCTC 8325. RNA-seq reads aligned to the NCTC 8325 genome are shown in blue. The locations of annotated genes are shown in gray. The locations of primers used for RT-PCR are shown in red. The predicted size and location of the Teg23.1 and Teg23.2 transcripts are shown by red arrows. (G) RT-PCR analysis of Teg23 transcript. PCR was performed using the primer pairs indicated and S. aureus genomic DNA (gDNA) (lane 1), cDNA from S. aureus containing the Teg23P-his plasmid (lane 2), cDNA from wild-type S. aureus (lane 3), or no DNA (lane 4). No PCR product was detected using primers 1 and 3 with S. aureus cDNA as the template.
- FIG 4
Location and comparative expression analysis of the 303 S. aureus USA300 sRNAs. The black outer ring shows the chromosomal locations of 303 sRNAs in strain USA300 (the outer circle shows the forward strand, while the inner circle shows the reverse strand). The inner rings show sRNA gene expression profile in TSB (outside, blue), human serum (inside, red), and heat map (middle) showing differences in expression. The heights of the blue or red bars are proportional to the expression values (the maximum displayed expression value was 1,000).
- FIG 5
Northern blot analysis of serum-regulated sRNAs in strain USA300. (A) Analysis of sRNAs demonstrating upregulation in human serum. RNA-seq read alignment data and Northern blot analysis are shown for SAUSA300s289 (tsr25) and SAUSA300s046 (rsaOG) during growth in TSB (T) or human serum (S). (B) Analysis of RNAIII expression in human serum and TSB. RNA-seq read alignment data are shown for the entire agr locus. Northern blot analysis was performed using an oligonucleotide probe specific for the RNAIII transcript. Annotations for CDS genes are shown by black arrows, annotations for sRNAs are shown by red arrows, and depth of read coverage on the genome is shown by the blue histograms.
- TABLE 1
Novel sRNAs identified in strain USA300
sRNA designation sRNA gene Stranda Location Size (nt) Chromosomal location of tsr gene in strain: USA300b MRSA252b NCTC 8325b SAUSA300s265 tsr1 > 52438−53094 656 IG − − SAUSA300s266 tsr2 < 57712−57804 92 IG − − SAUSA300s267 tsr3 < 61388−61550 162 IG − − SAUSA300s268 tsr4 > 73511−74139 628 AS AS AS SAUSA300s269 tsr5 < 79346−79425 79 AS − − SAUSA300s270 tsr6 > 120785−120897 112 IG IG IG SAUSA300s271 tsr7 > 169903−170079 176 IG − IG SAUSA300s272 tsr8 < 170013−170214 201 IG − IG SAUSA300s273 tsr9 < 228412−228796 384 IG CDS CDS SAUSA300s274 tsr10 > 349895−350058 163 IG OL OL SAUSA300s275 tsr11 < 356689−356782 93 OL OL OL SAUSA300s276 tsr12 > 457272−457333 61 IG OL AS SAUSA300s277 tsr13 > 484942−485025 83 OL OL OL SAUSA300s278 tsr14 > 834340−834885 545 IG IG AS SAUSA300s279 tsr15 > 896563−897379 816 AS AS AS SAUSA300s280 tsr16 < 911246−911364 118 AS OL OL SAUSA300s281 tsr17 < 973559−973971 412 IG CDS CDS SAUSA300s282 tsr18 < 1074292−1074484 192 IG CDS CDS SAUSA300s283 tsr19 < 1080302−1080394 92 IG IG IG SAUSA300s284 tsr20 < 1154300−1154753 453 IG − IG SAUSA300s285 tsr21 < 1154827−1156001 1174 CDS CDS3 CDS3 SAUSA300s286 tsr22 > 1165484−1165865 381 IG CDS CDS SAUSA300s287 tsr23 > 1256521−1256545 24 IG IG IG SAUSA300s288 tsr24 > 1429517−1429754 237 IG − IG SAUSA300s289 tsr25 > 1442862−1443042 180 IG AS AS SAUSA300s290 tsr26 > 1641611−1641732 121 IG IG − SAUSA300s291 tsr27 < 1642820−1642923 103 IG IG − SAUSA300s292 tsr28 < 1715900−1715975 75 OL OL OL SAUSA300s293 tsr29 < 1954961−1955091 130 IG − IG SAUSA300s294 tsr30 > 2126434−2126545 111 IG − − SAUSA300s295 tsr31 < 2244964−2245035 71 IG IG IG SAUSA300s296 tsr32 > 2337922−2338072 150 IG IG CDS SAUSA300s297 tsr33 < 2410564−2410648 84 IG IG IG SAUSA300s298 tsr34 > 2591032−2591131 99 IG IG IG SAUSA300s299 tsr35 > 2608047−2608594 547 IG CDS CDS SAUSA300s300 tsr36 < 2608120−2608645 525 IG AS AS SAUSA300s301 tsr37 > 2620285−2620621 336 IG CDS CDS SAUSA300s302 tsr38 < 2664856−2664945 89 IG IG IG SAUSA300s303 tsr39 < 2811278−2811330 52 IG IG IG ↵a >, forward strand; <, reverse strand.
↵b Characteristics of the chromosomal location of the tsr gene. IG, located in the intergenic region; −, absent, deleted, or no homologue; AS, antisense to the annotated gene; CDS, located within an existing annotated CDS; OL, partially overlaps CDS gene; CDS3, the corresponding locus contains three annotated CDSs.
- TABLE 2
42 sRNAs that are upregulated in human serum versus TSB
sRNA designation sRNA gene name or feature TSB expression value (RPKM)b Serum expression value (RPKM) Fold change SAUSA300s289 tsr25 60.67 35,374.06 583.02 SAUSA300s046 rsaOG 90.99 34,267.77 376.61 SAUSA300s053 RsaG 80.85 3,463.09 42.83 SAUSA300s119 ssr24 130.78 3,217.86 24.6 SAUSA300s153 Teg16 71.05 1,174.01 16.52 SAUSA300s066 Sau-63 104.99 1,690.95 16.11 SAUSA300s030 sprC 149.58 2,144.32 14.34 SAUSA300s026 ssrS 2,991.16 37,212.81 12.44 SAUSA300s005 ffs 929.74 11,188.00 12.03 SAUSA300s148 Teg23 256.6 2,950.59 11.5 SAUSA300s050 RsaD 2,737.91 30,473.59 11.13 SAUSA300s226 JKD6008sRNA173 50.05 539.79 10.78 SAUSA300s013 Lysine riboswitch 659.93 6,917.84 10.48 SAUSA300s260 JKD6008sRNA396 16.13 150.26 9.31 SAUSA300s294 tsr30 470.64 4,383.00 9.31 SAUSA300s027 sprA1 1,097.34 9,306.35 8.48 SAUSA300s233 JKD6008sRNA205 96.96 717.53 7.4 SAUSA300s003 T-box riboswitch 158.5 1,156.13 7.29 SAUSA300s094 Teg108 19.39 132.54 6.83 SAUSA300s099 Teg124 37.1 245.19 6.61 SAUSA300s110 sprA3 36.05 233.31 6.47 SAUSA300s282 tsr18 105.4 653.5 6.2 SAUSA300s024 GlmS ribozyme 185.53 1,064.95 5.74 SAUSA300s117 ssr8 12.13 67.9 5.6 SAUSA300s038 sprG3 191.04 1,049.33 5.49 SAUSA300s120 ssr28 188.03 1,012.53 5.39 SAUSA300s028 sprA2 99.08 504.62 5.09 SAUSA300s210 JKD6008sRNA071 136.39 691.13 5.07 SAUSA300s100 Teg124 469.39 2,313.98 4.93 SAUSA300s002 SAMa riboswitch 56.06 268.4 4.79 SAUSA300s031 sprD 804.11 3,810.91 4.74 SAUSA300s021 SAM riboswitch 239.09 941.21 3.94 SAUSA300s075 rsaOL 273.5 1,010.42 3.69 SAUSA300s091 Teg60 95.9 350.09 3.65 SAUSA300s034 sprF3 1,227.97 4,261.30 3.47 SAUSA300s016 T-box riboswitch 316.76 1,059.28 3.34 SAUSA300s084 Teg27 15,788.22 52,571.03 3.33 SAUSA300s042 rsaOC 26.75 88.89 3.32 SAUSA300s135 ssr100 322.65 1,050.22 3.26 SAUSA300s163 Teg28as 46.74 149.53 3.2 SAUSA300s079 rsaOU 0 85.01 ∞ SAUSA300s151 Teg134 0 204.13 ∞ - TABLE 3
41 sRNAs that are downregulated in human serum versus TSB
sRNA designation sRNA gene name or feature TSB expression value (RPKM)a Serum expression value (RPKM) Fold change SAUSA300s277 tsr13 509.65 0.43 −1,187.67 SAUSA300s113 sbrC 1,834.12 6.3 −291.07 SAUSA300s266 tsr2 122.44 0.42 −290.6 SAUSA300s296 tsr32 92.33 0.44 −210.63 SAUSA300s171 Sau-6569 41,077.46 250.83 −163.77 SAUSA300s049 RsaC 8,079.72 77.42 −104.37 SAUSA300s004 Purine riboswitch 2,277.90 45.36 −50.22 SAUSA300s303 tsr39 3,132.51 64.48 −48.58 SAUSA300s162 Teg25as 6,668.30 191.51 −34.82 SAUSA300s125 ssr47 6,272.84 256.03 −24.5 SAUSA300s052 RsaF 35,374.06 1,713.79 −20.64 SAUSA300s275 tsr11 398.93 20.01 −19.94 SAUSA300s301 tsr37 390.39 23.36 −16.72 SAUSA300s292 tsr28 513.06 31.91 −16.08 SAUSA300s297 tsr33 8,987.32 592.2 −15.18 SAUSA300s062 Sau-31 141.32 9.7 −14.57 SAUSA300s022 RNAIII 66,968.70 5,178.15 −12.93 SAUSA300s283 tsr19 162.04 13.93 −11.63 SAUSA300s118 ssr16 478.47 49.19 −9.73 SAUSA300s302 tsr38 251.17 27.55 −9.12 SAUSA300s280 tsr16 254.42 30.88 −8.24 SAUSA300s095 Teg116 1,149.05 155.21 −7.4 SAUSA300s211 JKD6008sRNA073 59.06 8 −7.38 SAUSA300s287 tsr23 970.48 133.71 −7.26 SAUSA300s054 RsaH 4,110.36 629.99 −6.52 SAUSA300s087 Teg41 481.01 74.55 −6.45 SAUSA300s078 rsaOT 17,890.11 2,790.22 −6.41 SAUSA300s127 ssr54 3,245.19 584.15 −5.56 SAUSA300s051 RsaE 2,929.20 534.76 −5.48 SAUSA300s074 rsaOI 721.93 135.52 −5.33 SAUSA300s237 JKD6008sRNA258 100.89 20.87 −4.83 SAUSA300s298 tsr34 200.17 41.54 −4.82 SAUSA300s267 tsr3 85.01 19.21 −4.43 SAUSA300s114 sbrE 424.58 102.21 −4.15 SAUSA300s073 Sau-6072 265.82 64.27 −4.14 SAUSA300s276 tsr12 295.29 73.2 −4.03 SAUSA300s291 tsr27 135.22 34.48 −3.92 SAUSA300s204 RsaX04 265.58 70.09 −3.79 SAUSA300s086 Teg39 50.39 13.67 −3.69 SAUSA300s141 ssr153 74.69 21.06 −3.54 SAUSA300s010 T-box riboswitch 487.82 149.37 −3.27 ↵a RPKM, reads per kilobase of transcript per million mapped reads.
- TABLE 4
Bacterial strains, plasmids, and primers used in this study
Bacterial strain, plasmid, or primer Characteristic(s) or sequence Reference or source Commenta S. aureus strains USA300 Houston Community-associated MRSA clinical isolate 26 SH1000 Laboratory strain; rsbU functional 29 UAMS-1 Osteomyelitis clinical isolate 30 RN4220 Restriction-deficient transformation recipient 31 AW2192 USA300 pMK4::teg23p-his6 This study E. coli strain DH5α Routine cloning strain Invitrogen Plasmids pMK4 Shuttle vector; Cmr 32 pAW105 pMK4::teg23P-his6 This study Primers OL1184 5′ TCTGGACCGTGTCTCAGTTCC 3′ 27 OL1185 5′ AGCCGACCTGAGAGGGTGA 3′ 27 OL2701 5′ CCAAATTTAGGCATGTCAAATCGGC 3′ teg23 probe OL3201 5′ GGATTCCCAATTTCTACAGACAATGCA 3′ tsr8 probe OL3208 5′ ACGGGCATATAAAAGGGGAATATTTGAAAA 3′ tsr25 probe OU0121 5′ GTGTTAAAAAAATAACTGGGATGTG 3′ tsr26 probe OL3216 5′ CTCACAAATTCTGTAAGGGGAGCGTAT 3′ tsr31 probe OL3217 5′ TTATGTCCCAATGCTGAATAAATAACTTC 3′ tsr33 probe OL3222 5′ ACGCGTCGACGCGCTTGTATTCGCTGCAGG 3′ teg23P F OL3223 5′ CGGGATCCTTAGTGGTGGTGGTGGTGGTGCGCCAACAAGGTTTCAAGAGC 3′ teg23P-his6 R OL3232 5′ CGCCAACAAGGTTTCAAGAGC 3′ teg23 OL1 OL3281 5′ TAAACAACATACAGCCATTG 3′ teg23 OL2 OL3282 5′ GAGAATTTGAAGGCAAGTAT 3′ teg23 OL3 OL3880 5′ GCCAGGATAATGTAGTCTTAA 3′ tsr1 F OL3882 5′ CCATTAATTTACTCAAACCG 3′ tsr1 R OL3885 5′ GCTTCTGTTCGATCTC 3′ tsr2 F OL3886 5′ CACGTCTTCTGATTAAAC 3′ tsr2 R OL3916 5′ CATACCTCTTTAACAACAG 3′ tsr18 F OL3917 5′ GGAGGAATTAATCATGTC 3′ tsr18 R OL3935 5′ GAAGGGATCCAACACA 3′ tsr24 F OL3937 5′ GTCTCGCCATTAATACTAC 3′ tsr24 R OL3946 5′ GTCTTTTCACAACCAAAG 3′ tsr29 F OL3948 5′ GGTTTTATCTTTGGAAAAAG 3′ tsr29 R OL3956 5′ GATGCGGAAAATTTGG 3′ tsr32 F OL3957 5′ GTGCGCAATGAATATTATG 3′ tsr32 R ↵a F, forward; R, reverse.
Supplemental Material
Figure S1
Schematic outlining the procedure used to locate and annotate sRNAs in S. aureus. (A) Using information provided in previous studies, the approximate locations of reported sRNAs were identified. (B) RNA-seq was performed, and reads were aligned to the relevant S. aureus genome. (C) The locations of aligned reads were used to precisely locate and annotate sRNAs (blue arrow). Download Figure S1, TIF file, 2 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Table S1
25 miscellaneous RNAs from S. aureus MRSA252 genome. Table S1, DOCX file, 0.1 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Table S2
Names and designations for 953 previously identified and 39 newly identified sRNAs in S. aureus strains USA300, MRSA252, and NCTC 8325. Table S2, XLSX file, 0.1 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Text S1
Supplemental methods. Download Text S1, DOCX file, 0.2 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Figure S2
Distribution of tsr genes in strains USA300, NCTC 8325, and MRSA252. Five tsr genes are unique to strain USA300. An additional five are found in strains USA300 and NCTC 8325 (but not MRSA252), while two are found in USA300 and MRSA252 (but not NCTC 8325). Twenty-seven tsr genes are found in all three strains. Download Figure S2, TIF file, 0.5 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Figure S3
RNA-seq read alignment data for sarR and tsr33 during growth in human serum. Annotations for CDS genes are shown by black arrows, and the annotation for sRNA is shown by a red arrow. The depth of read coverage on the genome is shown by blue histogram. Greater depth of read coverage for tsr33 suggests that a sarR-independent tsr33 exists under these conditions. Download Figure S3, TIF file, 0.4 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Table S3
Expression values for 303 S. aureus USA300 sRNA genes in TSB and human serum. Table S3, XLSX file, 0.1 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Figure S4
Reverse transcriptase PCR-based detection of newly identified sRNAs in S. aureus. PCRs were performed with primers specific to newly identified sRNA genes. DNA-depleted RNA, DNA, and H2O were employed as the templates to verify the complete removal of DNA from RNA samples, the correct sizes of the respective amplicons, and the absence of DNA contaminations. Successful, size-specific amplification of a target from cDNA suggests the presence of transcript at the position where a novel sRNA annotation was added to the genome file. Download Figure S4, TIF file, 0.5 MB.
Copyright © 2016 Carroll et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Additional Files
Supplementary Data
Supplementary Data
- Text s1, DOCX - Text s1, DOCX
- Figure sf1, TIF - Figure sf1, TIF
- Figure sf2, TIF - Figure sf2, TIF
- Figure sf3, TIF - Figure sf3, TIF
- Figure sf4, TIF - Figure sf4, TIF
- Table st1, DOCX - Table st1, DOCX
- Table st2, XLSX - Table st2, XLSX
- Table st3, XLSX - Table st3, XLSX
