Article Figures & Data
- FIG 1
The tss and idr genes are necessary for self-recognition. (A) Diagrammatic representations of the boundary behavior patterns exhibited by mutants isolated in the screen, matched with the swarm plates below. (B) Swarm agar plates inoculated with P. mirabilis strains exhibited the boundary formation behavior of two representative mutants isolated from the self-recognition screen: the tssN* mutant strain, which merged with all other BB2000-derived strains (left), the complemented tssN* mutant strain carrying plasmid pLW100, which formed a boundary with the ∆ids strain (center), and the idrB* mutant, which formed boundaries with all other strains (right). (C) Diagram of the putative type VI secretion (tss) gene locus with sites of the transposon insertions, as depicted by lollipops. (D) Diagram of the idr gene locus with sites of the transposon insertions, as depicted by lollipops. For panels C and D, the dark gray shading indicates 97% or higher identity for the predicted polypeptide sequences of the tss and idr genes between strains BB2000 and HI4320; otherwise, specific identities are provided underneath. The dashed box indicates the region of idrD that shares sequence similarity between strains BB2000 and HI4320. Slanted lines indicate a break in the genomic regions, corresponding to approximately 8 kb.
- FIG 2
Competitions between P. mirabilis strains. (A) Competitions between mutant strains and the parent strain BB2000 on surfaces were initiated at a 1:1 ratio, and the mixed populations were permitted to swarm against either BB2000 or the mutant strain (n = 12). Population dominance was measured as the ability of the mixed swarm to merge with either BB2000, indicating BB2000 dominance, or the mutant strain, indicating dominance of the mutant strain. Unclear boundaries were classified as “neither.” (B) To observe the spatial distribution of coswarming P. mirabilis strains over time, BB2000 c. pKG101 (16) was competed against BB2000 or the ∆ids, tssN*, or idrB* mutant. Overnight cultures were normalized to an OD600 of 0.1. Competing strains were mixed in a 1:1 ratio, and 0.5 µl of each coculture was spotted onto the center of a CM55 agar plate (n = 3). After incubation first at room temperature for 22 h and then at 37°C for 6 h, each swarm consisted of four swarm rings and was patched using a half-plate 48-prong device onto selective plates that could detect the marked BB2000 strain (LSW− Kn) and, when applicable, the mutant strain (LSW− Cm). Swarms of BB2000 versus BB2000 were also plated nonselectively onto LSW− agar. Representative photographs of the swarm plates, after sampling for migration distance, are depicted in the lower portion. (C) Competitions between BB2000, the BB2000 mutant strains, and an independent strain, HI4320, were initiated at a 1:1 ratio, and the mixed populations were swarmed against either a BB2000 mutant strain or HI4320. The BB2000 mutant strain was defined as dominant when the mixed population merged with the BB2000 mutant strain, while HI4320 was dominant if the mixed population merged with the HI4320 swarm. n = 6 for the tssN* strain, 12 for the ∆ids and idrB* strains, and 18 for BB2000.
- FIG 3
Proteins involved in self-recognition are exported outside the cell. (A) LC-MS/MS peptide hits for proteins in the culture supernatants of wild-type BB2000 and the ∆ids mutant strains. For BB2000 and the idrB* strains, an additional 6 unique (74 total) and 4 unique (28 total) peptides, respectively, could be assigned to either IdsA or IdrA, due to high similarity of the two proteins (indicated by a plus sign). (B) The secretion profiles of the wild-type, ∆ids, and tssN* strains were examined by gel electrophoresis followed by Coomassie blue staining. The identity of bands corresponding to IdsA and IdrA were confirmed by LC-MS/MS. (C) Western blots of extracellular secretions (left) and whole-cell extracts (right) isolated from strains expressing IdsA-FLAG. The ∆ids c. pidsBB strain was included as a negative control for the FLAG epitope. For ∆ids expressing IdsA-FLAG in trans, the FLAG epitope was engineered in frame into an expression plasmid that contains the entire ids operon under native control. (D) Western blots of extracellular secretions (left) and whole-cell extracts (right) isolated from the indicated strains using a polyclonal anti-IdsB antibody. The asterisks mark the size of the expected band.
- FIG 4
Model for Ids and Idr functional roles in self-recognition. (A) Functional flow chart for the roles of the Ids, Idr, and T6S proteins in self-recognition and territorial behaviors. A subset of Ids and Idr proteins are primarily exported via a shared T6S system (tss) and are necessary for competition on surfaces with the parent strain. Idr proteins are also needed for competition against foreign strains. (B) Our proposed model for self-recognition predicts that the combined actions of interactions between cognate Ids and Idr proteins between two neighboring cells result in the determination that self is present, ultimately resulting in the merging of two swarms. Expression of the self-recognition components within the cells is sufficient, though in wild-type strains, some of these components are exported from the cell by a T6S system. In contrast, absence of one or more of the Ids and Idr self-recognition systems leads to the determination that self is absent and ultimately to boundary formation.
- TABLE 1
Bacterial strains and plasmids
Strain or mutation Genotype Reference or source Proteus mirabilis BB2000 Wild type 32 HI4320 Wild type 18, 40 ∆ids ∆ids::Cmr 15 ∆ids c. pidsBB ∆ids::Cmr carrying a plasmid expressing the ids operon under the control of the
ids upstream region15 idrB* idrB::Tn-Cmr This study idrC* idrC::Tn-Cmr This study idrD* idrD::Tn-Cmr 15 tssA* tssA::Tn-Cmr This study tssB* tssB::Tn-Cmr This study tssG* tssG::Tn-Cmr This study tssM* tssM::Tn-Cmr This study tssN* tssN::Tn-Cmr This study BB2000 c. pKG101 Wild type carrying a plasmid with Knr and promoter-less gfp 16 tssN* c. pLW100 tssN::Tn-Cmr strain carrying a plasmid expressing tssNOPQ under the control
of the tssA upstream regionThis study BB2000 c. pLW101 Wild type carrying a plasmid expressing IdsA-FLAG in which a FLAG was engineered
to the C terminus of IdsA in the pidsBB vectorThis study ∆ids c. pLW101 ∆ids::Cmr strain carrying a plasmid expressing IdsA-FLAG in which a FLAG was
engineered to the C terminus of IdsA in the pidsBB vectorThis study tssN* c. pLW101 tssN*::Cmr strain carrying a plasmid expressing IdsA-FLAG in which a FLAG was
engineered to the C terminus of IdsA in the pidsBB vectorThis study Escherichia coli SM10λpir c. pUTmini-Tn5-Cm Cmr 41 S17-1λpir 41 XL10-Gold ultracompetent cells Agilent Technologies,
Santa Clara, CA
Supplemental Material
Table S1
For the wild-type parent strain BB2000, listed are the unique peptide results for Ids and Idr proteins, acquired by LC-MS/MS. Peptide fragments that could correspond to either IdsA or IdrA are marked as such. The minimum detection cutoff recommended by the Taplin Biological Mass Spectrometry Facility was three unique peptides. Table S1, DOCX file, 0.1 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Figure S1
Boundary assays with tssN* mutant strains. (A) Diagrammatic representations of the boundary behavior patterns exhibited by the indicated strains, matched with the swarm plate to the right. (B) On this swarm agar plate, the tssN* mutant strain carrying plasmid pLW103, which encodes tssN expression alone, merged with both the ∆ids strain (top) and the parent BB2000 (left), as did the tssN* mutant strain. The tssN-expressing plasmid, pLW103, carries the tssN gene under the transcriptional control of the proposed promoter contained in the region immediately upstream of the tss gene cluster. This plasmid was constructed as follows: pLMW100 was digested at NheI and XmaI sites to obtain the vector backbone; tssN and the 1,200-bp upstream region were then PCR amplified from pLMW100 using primers 5′ ATAGCTAGCTCGAGGCCTCTCATTACAGTAGCAATATTGAGAGAAGATT 3′ and 5′ ATACCCGGGCCCGCGGTTAATAAAGCGTTTCAGGTAAACGGA 3′; this product was then digested with NheI and XmaI and ligated with the vector backbone. The plasmid pLW103 was then transformed into E. coli S17λpir using standard protocols and subsequently conjugated into the tssN* mutant strain. Download Figure S1, EPS file, 0.4 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Figure S2
There is no clear disadvantage to loss of self-recognition in liquid competitions. No significant difference was seen between the growth of BB2000 and that of each self-recognition mutant when the strains were grown together in liquid broth after 3 h (as measured by a two-tailed t test; P = 0.38, 0.39, and 0.14 for the ∆ids, tssN*, and idrB* strains, respectively) and after 20 h (as measured by a two-tailed t test; P = 0.22, 0.89, and 0.31 for ∆ids, tssN*, and idrB*, respectively). These results suggest that the self-recognition components do not confer a competitive advantage under liquid-growth conditions. The constitutive lacZ expression plasmid pLW102 carries the lacZ gene under the transcriptional control of the fla and lac promoters. This plasmid was constructed as follows: pKG105 (16) was digested at SacI and AgeI sites to obtain the vector backbone; gene lacZ was then PCR-amplified from pQF50 (M. A. Farinha and A. M. Kropinski, J. Bacteriol. 172:3496-3499, 1990) using primers 5′ CATGAGCTCATGAAAGGGAATTCACTGGCC 3′ and 5′ TAAACCGGTTTATTTTTGACACCAGACCAACTG 3′; after digestion with SacI and AgeI, this product was then ligated with the vector backbone. The ligation reaction was transformed into Stellar competent cells (Clontech Laboratories, Mountain View, CA). The plasmid pLW102 was then transformed into E. coli S17λpir using standard protocols and subsequently conjugated into wild-type BB2000. BB2000 c. pLW102 was competed against BB2000 c. pKG101, the ∆ids c. pKG101 strain, the tssN* c. pKG101 strain, or the idrB* c. pKG101 strain. Overnight cultures were back-diluted to an OD600 of 0.1 in 3 ml LB+Kn and rotated at 37°C until late-log-phase growth. Cultures were then normalized to an OD600 of 3.5. The competing strains were mixed together in a 1:10 BB2000-to-mutant ratio, back-diluted to a 1:3 ratio in LB+Kn for a total volume of 1.5 ml, and incubated at 37°C while shaking at 225 rpm. After 3 h and 20 h of growth, cells were spotted on nonselective (LSW−+Kn and 300 µg/ml X-Gal [5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside]) and, when applicable, selective (LSW−+Cm) plates to measure for colony-forming units (CFU). The resultant ratio of CFU of each strain was compared to the initial inoculation ratio to calculate fold change. Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA). Download Figure S2, EPS file, 0.5 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Figure S3
Dot blot analysis of IdsA-FLAG. IdsA-FLAG, expressed in trans in P. mirabilis cells, was found in the supernatant and on the cell surface of wild-type BB2000 and in severely decreased amounts in the tssN* mutant strain. The blot on the left was probed with an anti-FLAG antibody primary, while an anti-sigma -70 antibody was used to probe the blot on the right as a control for cell lysis. These results confirm that IdsA requires tssN for proper export out of the cell, as indicated by the LC-MS/MS and Western blot analyses. This result suggests that IdsA is normally located and exposed on the cell surface. Samples for whole-cell immunoblots were prepared as described previously (D. Newell, R. D. Monds, and G. A. O’Toole, Proc. Natl. Acad. Sci. U. S. A. 106:3461-3466, 2009). Briefly, cell cultures were grown to late-logarithmic phase. “Cell culture” samples were prepared by spotting cell culture directly onto nitrocellulose membrane in five 5-µl aliquots for a total of 25 µl in each spot. For “cell surface” samples, the loosely adhered portion of a cell pellet from 5 ml of cell culture was gently resuspended in 1 ml LB and spotted on the membrane as described above. For “lysed cell” samples, cells from 10 ml of culture were collected by centrifugation and resuspended in 1 ml lysis buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, and protease inhibitor cocktail [Roche, Indianapolis, IN]). Cells were lysed by vortexing with cell disruptor beads (Electron Microscopy Sciences, Hatfield, PA) and centrifuged to remove cell debris. The soluble fraction was spotted onto the membrane as described above. The dot immunoblot was then developed similarly to the above-described Western blots using one of two primary antibodies: mouse anti-FLAG (Sigma-Aldrich, Allentown, PA) or mouse anti-sigma70 (Pierce Biotechnology, Rockford, IL). Download Figure S3, EPS file, 1.1 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Table S2
For the ∆ids mutant strain, listed are the unique peptide results for Ids and Idr proteins, acquired by LC-MS/MS. The minimum detection cutoff recommended by the Taplin Biological Mass Spectrometry Facility was three unique peptides Table S2, DOCX file, 0.1 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Table S3
For the idrB* mutant strain, listed are the peptide results for Ids and Idr proteins, acquired by LC-MS/MS. Peptide fragments that could correspond to either IdsA or IdrA are marked as such. The minimum detection cutoff recommended by the Taplin Biological Mass Spectrometry Facility was three unique peptides. Table S3, DOCX file, 0.1 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Table S4
For the tssN* mutant strain, listed are the unique peptide results for Ids and Idr proteins, acquired by LC-MS/MS. Peptide fragments that could correspond to either IdsA or IdrA are marked as such. Consistent with the dot blots, the tssN* mutant strain is greatly attenuated for IdsA or IdrA export, though not completely deficient. The tssN* mutant strain does not export any of the remaining Ids and Idr proteins. The minimum detection cutoff recommended by the Taplin Biological Mass Spectrometry Facility was three unique peptides, which IdrA/IdsA did not achieve for the tssN* sample. Table S4, DOCX file, 0.1 MB.
Copyright © 2013 Wenren et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-ShareAlike 3.0 Unported license, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Additional Files
Supplementary Data
Supplementary Data
Files in this Data Supplement:
- Figure sf01, EPS - Figure sf01, EPS
- Figure sf02, EPS - Figure sf02, EPS
- Figure sf03, EPS - Figure sf03, EPS
- Table st1, DOCX - Table st1, DOCX
- Table st2, DOCX - Table st2, DOCX
- Table st3, DOCX - Table st3, DOCX
- Table st4, DOCX - Table st4, DOCX
