Article Figures & Data
Figures
- FIG 1
Concentration-time profiles of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the cassette assay of the polymyxin-susceptible E. cloacae isolate EC3800. β-Lactams were dosed at 3 mg/liter of each drug for the supernatant control and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (3.2 × 109 cells/ml) after six washes and immediately before adding the antibiotics to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (6.4 × 108 cells/ml) after the washes and immediately before lysing. The data (Table 1) represent biological triplicates. The individual profiles for all replicates are presented in the supplemental material.
- FIG 2
Concentration-time profiles of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the cassette assay of the polymyxin-resistant K. pneumoniae isolate KP3800. β-Lactams were dosed at 3 mg/liter of each drug for the supernatant control and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (9.0 × 108 cells/ml) after six washes and immediately before adding the antibiotics to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (1.8 × 108 cells/ml) after the washes and immediately before lysing. The data (Table 1) represent biological triplicates. The individual profiles for all replicates are presented in the supplemental material.
- FIG 3
Concentration-time profiles of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the discrete assay of the polymyxin-susceptible E. cloacae isolate EC3800. β-Lactams were dosed at 3 mg/liter of each drug for the supernatant control and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (6.3 × 108 for imipenem, 4.2 × 109 for meropenem, 3.6 × 109 for cefepime, 3.8 × 109 for aztreonam, and 3.5 × 109 for ceftazidime) after six washes and immediately before adding the antibiotic to the intact bacteria arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (6.3 × 108 for imipenem, 8.4 × 108 for meropenem, 7.2 × 108 for cefepime, 7.6 × 108 for aztreonam, and 7.0 × 108 for ceftazidime) after the washes and immediately before lysing. The data (Table 1) represent biological triplicates. The individual profiles for all replicates are presented in the supplemental material.
- FIG 4
Concentration-time profiles of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the discrete assay of the polymyxin-resistant K. pneumoniae isolate KP3800. β-Lactams were dosed at 3 mg/liter each drug for the supernatant control and at 1, 3, or 10 mg/liter each drug for intact bacteria arms (A to E). (F) Bacterial density (1.1 × 108 for imipenem, 3.0 × 109 for meropenem, 9.5 × 108 for cefepime, 7.8 × 108 for aztreonam, and 7.5 × 108 for ceftazidime) after six washes and immediately before adding the antibiotic to the intact bacteria arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter each drug for lysed cells arms (G to K). (L) Bacterial density (1.1 × 108 for imipenem, 6.0 × 108 for meropenem, 1.9 × 108 for cefepime, 1.5 × 108 for aztreonam, and 1.6 × 108 for ceftazidime) after the washes and immediately before lysing. The data (Table 1) represent biological triplicates. The individual profiles for all replicates are presented in the supplemental material.
Tables
- TABLE 1
Outer membrane permeability coefficients for imipenem, meropenem, cefepime, aztreonam and ceftazidime for the polymyxin-susceptible E. cloacae (EC3800) and the polymyxin-resistant K. pneumoniae (KP3800) isolatesa
↵a Data were determined via a discrete and a cassette assay, and additional cassette assay (“efflux”) studies were carried out with 25 mg/liter phenylalanine-arginine β-naphthylamide (PAβN) as an efflux pump inhibitor. Estimates represent averages from three biological replicates for the cassette and discrete assays and two biological replicates for efflux inhibitor assay. TSTD, too slow to be determined (for the initial inocula used; TSTD is equivalent to a permeability coefficient of <0.6 nm/s for the experiments with E. cloacae isolate and <3 nm/s for the K. pneumoniae isolate); NA, not quantifiable in this isolate due to insufficient hydrolysis of ceftazidime.
- TABLE 2
Protein production in strain ATCC 13833, a polymyxin-resistant K. pneumoniae isolate (KP3800), and a polymyxin-susceptible E. cloacae isolate (EC3800)
TABLE S1
Predicted average unbound steady-state concentrations of five β-lactams in critically ill patients at the maximum clinical dose given as continuous infusion. Download Table S1, DOCX file, 0.03 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S1
Concentration-time profiles of imipenem, meropenem, cefepime, aztreonam, and ceftazidime for the cassette assay using the supernatant control (after 2 h of incubation) from the E. cloacae EC3800 (left) and the K. pneumoniae KP3800 (right) isolate. Download FIG S1, TIF file, 0.3 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S2
Concentration-time profiles (left, second replicate; right, third replicate) of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the cassette assay using the E. cloacae EC3800 isolate. β-Lactams were dosed at 3 mg/liter of each drug for supernatant control and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (left, 3.6 × 109 cells/ml; right, 4.0 × 109 cells/ml) after six washes and immediately before adding the antibiotics to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (left, 7.2 × 108 cells/ml; right, 8.0 × 108 cells/ml) after the washes and immediately before lysing. Download FIG S2, TIF file, 1.7 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S3
Concentration-time profiles (left, second replicate; right, third replicate) of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the cassette assay using K. pneumoniae KP3800. β-Lactams were dosed at 3 mg/liter of each drug for supernatant control, and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E); panel (F) shows the bacterial density (left: 8.0 × 108 cells/ml; right: 1.05 × 109 cells/ml) after six washes and immediately before adding the antibiotics to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K); panel (L) shows the bacterial density (left: 1.6 × 108 cells/ml; right: 2.1 × 108 cells/ml) after the washes and immediately before lysing. Download FIG S3, TIF file, 1.7 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S4
Concentration-time profiles (left, second replicate; right, third replicate) of imipenem, meropenem, cefepime, ceftazidime and aztreonam for the discrete assay using E. cloacae EC3800. β-Lactams were dosed at 3 mg/liter of each drug for supernatant control, and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (left, 5.1 × 108 for imipenem, 3.0 × 109 for meropenem, 3.4 × 109 for cefepime, 4.0 × 109 for aztreonam, and 3.9 × 109 for ceftazidime; right, 5.4 × 108 for imipenem, 2.7 × 109 for meropenem, 3.5 × 109 for cefepime, 3.5 × 109 for aztreonam, and 3.5 × 109 for ceftazidime) after six washes and immediately before adding the antibiotic to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (left, 5.1 × 108 for imipenem, 6.0 × 108 for meropenem, 6.8 × 108 for cefepime, 8.0 × 108 for aztreonam, and 7.8 × 108 for ceftazidime; right, 5.4 × 108 for imipenem, 5.4 × 108 for meropenem, 7.0 × 108 for cefepime, 7.0 × 108 for aztreonam, and 7.0 × 108 for ceftazidime) after the washes and immediately before lysing. Download FIG S4, TIF file, 1.7 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S5
Concentration-time profiles (left, second replicate; right, third replicate) of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the discrete assay using the K. pneumoniae KP3800 isolate. β-Lactams were dosed at 3 mg/liter of each drug for supernatant control, and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (left, 1.3 × 108 for imipenem, 1.0 × 109 for meropenem, 7.5 × 108 for cefepime, 8.0 × 108 for aztreonam, and 9.0 × 108 for ceftazidime; right, 1.3 × 108 for imipenem, 7.5 × 108 for meropenem, 7.0 × 108 for cefepime, 7.0 × 108 for aztreonam, and 6.0 × 108 for ceftazidime) after six washes and immediately before adding the antibiotic to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (left, 1.3 × 108 for imipenem, 2.0 × 108 for meropenem, 1.5 × 108 for cefepime, 1.6 × 108 for aztreonam, and 1.8 × 108 for ceftazidime; right, 1.3 × 108 for imipenem, 1.5 × 108 for meropenem, 1.4 × 108 for cefepime, 1.4 × 108 for aztreonam, and 1.2 × 108 for ceftazidime) after the washes and immediately before lysing. Download FIG S5, TIF file, 1.7 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S6
Concentration-time profiles (left, first replicate; right, second replicate) of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the cassette assay (with 25 mg/liter PAβN) using E. cloacae EC3800 . β-Lactams were dosed at 3 mg/liter of each drug for supernatant control and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (left, 3.0 × 109 cells/ml; right, 2.75 × 109 cells/ml) after six washes and immediately before adding the antibiotics to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (left, 6.0 × 108 cells/ml; right, 5.5 × 108 cells/ml) after the washes and immediately before lysing. Download FIG S6, TIF file, 1.8 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S7
Concentration-time profiles (left, first replicate; right, second replicate) of imipenem, meropenem, cefepime, ceftazidime, and aztreonam for the cassette assay (with 25 mg/liter PAβN) using K. pneumoniae KP3800. β-Lactams were dosed at 3 mg/liter of each drug for supernatant control and at 1, 3, or 10 mg/liter of each drug for intact bacteria arms (A to E). (F) Bacterial density (left, 9.0 × 108 cells/ml; right, 8.0 × 108 cells/ml) after six washes and immediately before adding the antibiotics to the intact cell arms. β-Lactams were dosed at 1, 3, 10, or 30 mg/liter of each drug for lysed bacteria arms (G to K). (L) Bacterial density (left, 1.8 × 108 cells/ml; right, 1.6 × 108 cells/ml) after the washes and immediately before lysing. Download FIG S7, TIF file, 1.9 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
TABLE S2
Outer membrane permeability coefficients (nm/s) for imipenem, meropenem, cefepime, aztreonam and ceftazidime for three KPC-2-producing K. pneumoniae. Data were determined via a discrete assay. Estimates represent the average ± the SD from three biological replicates for and KP3800 and a single biological assay for KP6478 and KP6484 (for the latter two strains, the employed MgCl2 concentration was 0.52 mM and the CaCl2 concentration 0.62 mM; in total 1.14 mM for these divalent cations). Download Table S2, DOCX file, 0.02 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
FIG S8
Relative gene expression for two clinical, carbapenem-resistant isolates of E. cloacae (EC3800, grey colony) and K. pneumoniae (KP3800, white colony). The RNA extraction was performed under the same biological conditions as the samples obtained for proteomic analysis. Relative expression was normalized to that of K. pneumoniae strain ATCC 13883. Six biological replicates and two technical replicates (i.e., a total of 12 runs) were performed. *, For the calculation of blaKPC-2 a consensus value of 1 was used for the K. pneumoniae strain ATCC 13883. The primer sequences (5′ to 3′) used in this study were GCAATATTCTGGCAGTGGTGATC for RT-ompK35-F1, ACCATTTTTCCATAGAAGTCCAGT for RT-ompK35-R1, TTAAAGTACTGTCCCTCCTGG for RT-ompK36-F1, TCAGAGAAGTAGTGCAGACCGTCA for RT-ompK36-R1, CGTGACGGAAAGCTTACAAA for RT-KPC-F1, AGCCAATCAACAAACTGCTG for RT-KPC-R1, TCAAACCAGGTGTGCAGGTA for RT-acrB-F, TTAATACCCAGACCGGATGC for RT-acrB-R, AAGGCGTTCATTCTACCACC for RT-mgrB-F, TTAAGAAGGCCGTGCTATCC for RT-mgrB-R, TTGACGTTACCCGCAGAAGAA for RT-rrsE-F, and GCTTGCACCCTCCGTATTACC for RT-rrsE-R. Download FIG S8, TIF file, 0.2 MB.
This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.
